About this deal
Goodman, A. D., Anadani, N. & Gerwitz, L. Siponimod in the treatment of multiple sclerosis. Expert Opin. Investig. Drugs 28, 1051–1057. https://doi.org/10.1080/13543784.2019.1676725 (2019). Song, J. H., Kim, G. T., Park, K. H., Park, W. J. & Park, T. S. Bioactive sphingolipids as major regulators of coronary artery disease. Biomol. Ther. 29, 373–383. https://doi.org/10.4062/biomolther.2020.218 (2021).
Pham, D. H., Moretti, P. A., Goodall, G. J. & Pitson, S. M. Attenuation of leakiness in doxycycline-inducible expression via incorporation of 3’ AU-rich mRNA destabilizing elements. Biotechniques 45, 155–156. https://doi.org/10.2144/000112896 (2008). This standard also includes groove recommendations for staic, hydraulic and pneumatic applications ISO3601 Size To generate doxycycline-inducible S1P 2 shRNA contructs the pTRIPz lentiviral vector was modified with the addition of a poly-linker as described previously 13. shRNA target sequences from Fellmann et al. 42, S1PR2 (5′ TGCTGTTGACAGTGAGCGCAAGGCACTGACTAGTCACATATAGTGAAGCCACAGATGTATATGTGACTAGTCAGTGCCTTATGCCTACTGCCTCGGA) and Renilla luciferase 713 negative control (5′ TGCTGTTGACAGTGAGCGCAGGAATTATAATGCTTATCTATAGTGAAGCCACAGATGTATAGATAAGCATTATAATTCCTATGCCTACTGCCTCGGA). shRNA oligonucleotides were amplified using EcoRI MirE primers (5′ TAGAATTCTGCACTTCTTAACCCAACAGAAGGCTCGAGAAGGTATATTGCTGTTGACAGTGAGCG, 3′ TCTCGAATTCTAGCCCCTTGAAGTCCGAG-GCATAGGC). PCR products were digested with EcoRI and cloned into pTRIPZ. To generate lentivirus, HEK293T cells were co-transfected with this vector (or empty pTRIPZ) and pLP1 (gag/pol), pLP2 (rev), pTAT and pVSVG vectors using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer’s instructions. Two days after transfection the media was changed from DMEM (10% FBS) to RPMI (10% FBS) and incubated for a further two days. The viral supernatant was then added to 5 × 10 6 MV411 cells containing 4 µg/ml polybrene and incubated for an additional 72 h prior to selection with 1 µg/ml of puromycin. Doxycycline induced RFP expression confirmed transduction efficiencies of > 80%. The sphingosine 1-phosphate receptor 2/4 antagonist JTE-013 elicits off-target effects on sphingolipid metabolism Roberts, J. L. et al. An assay for sphingosine kinase activity using biotinylated sphingosine and streptavidin-coated membranes. Anal. Biochem. 331, 122–129. https://doi.org/10.1016/j.ab.2004.03.030 (2004).Park, S. J. & Im, D. S. Deficiency of sphingosine-1-phosphate receptor 2 (S1P2) attenuates bleomycin-induced pulmonary fibrosis. Biomol. Ther. 27, 318–326. https://doi.org/10.4062/biomolther.2018.131 (2019). Lum, K. M. et al. Mapping protein targets of bioactive small molecules using lipid-based chemical proteomics. ACS Chem. Biol. 12, 2671–2681. https://doi.org/10.1021/acschembio.7b00581 (2017).
Sphingosine kinase assays using purified recombinant SK1 (1 ng) and SK2 (10 ng) 44, 45 were performed with JTE-013 or DMSO using fatty acid-free BSA (0.1%) solubilized-sphingosine (10 µM), ATP (100 µM) and 1 μCi [γ 32P]ATP in 100 mM Tris/HCl (pH 7.4), containing 150 mM NaCl, 1 mM Na 3VO 4, 10 mM NaF (100 µl total reaction volume), incubated for 30 min at 37 °C, as described previously 46. SK1 degradation assays Venant, H. et al. The sphingosine kinase 2 inhibitor ABC294640 reduces the growth of prostate cancer cells and results in accumulation of dihydroceramides in vitro and in vivo. Mol. Cancer Ther. 14, 2744–2752. https://doi.org/10.1158/1535-7163.MCT-15-0279 (2015). Simon, M. V. et al. Sphingolipids as critical players in retinal physiology and pathology. J. Lipid Res. 62, 100037. https://doi.org/10.1194/jlr.TR120000972 (2021). Ikeda, H. et al. Antiproliferative property of sphingosine 1-phosphate in rat hepatocytes involves activation of Rho via Edg-5. Gastroenterology 124, 459–469. https://doi.org/10.1053/gast.2003.50049 (2003). The relationship between sphingosine-1-phosphate receptor 2 and epidermal growth factor in migration and invasion of oral squamous cell carcinomaNewton, J., Lima, S., Maceyka, M. & Spiegel, S. Revisiting the sphingolipid rheostat: Evolving concepts in cancer therapy. Exp. Cell Res. 333, 195–200. https://doi.org/10.1016/j.yexcr.2015.02.025 (2015). Green, C. D., Maceyka, M., Cowart, L. A. & Spiegel, S. Sphingolipids in metabolic disease: The good, the bad, and the unknown. Cell Metab. 33, 1293–1306. https://doi.org/10.1016/j.cmet.2021.06.006 (2021). Brinkmann, V. et al. Fingolimod (FTY720): Discovery and development of an oral drug to treat multiple sclerosis. Nat. Rev. Drug Discov. 9, 883–897. https://doi.org/10.1038/nrd3248 (2010). Even in times of a national crisis, fraudsters will go to extraordinary lengths to divert funds away from the public sector. Analysis of HEK293T gene expression of S1PR1-5 was performed by quantitative reverse transcriptase PCR (qPCR) as previously described 13 using 5 × 10 6 HEK293T cells. Expression of the S1PR1-5 was analysed using the Rotor-Gene Q Series software (Qiagen) using the comparative quantitation method with HEK293T amplified S1PR1 used as the calibrator. Gene expression of S1PR2 in control and S1P 2 shRNA MV411 cell lines was analysed as above, normalized to GADPH and analysed using the Rotor-Gene Q Series software (Qiagen) using the comparative quantitation method with MV411 amplified S1PR2 used as the calibrator. Intact cell assay for Des1 activity
Wang, Z. et al. Molecular basis of sphingosine kinase 1 substrate recognition and catalysis. Structure 21, 798–809. https://doi.org/10.1016/j.str.2013.02.025 (2013). Pyne, N. J. & Pyne, S. Selectivity and specificity of sphingosine 1-phosphate receptor ligands: “off-targets” or complex pharmacology?. Front. Pharmacol. 2, 26. https://doi.org/10.3389/fphar.2011.00026 (2011).Long, J. S. et al. Sphingosine 1-phosphate receptor 4 uses HER2 (ERBB2) to regulate extracellular signal regulated kinase-1/2 in MDA-MB-453 breast cancer cells. J. Biol. Chem. 285, 35957–35966. https://doi.org/10.1074/jbc.M110.117945 (2010). Purified Des1-FLAG protein was assayed with NBD-C6-dhCer in 1% fatty acid-free BSA, 1 mM NADPH, 50 µM (NH 4) 2Fe(SO 4) 2 (prepared with 3 × molar excess ascorbic acid) and recombinant cytochrome B5 (CYB5) in 50 mM Tris–HCl buffer (pH 7.2) with 1 mM DTT. The reaction was incubated at 37 °C for 30 min, and then terminated by the addition of methanol and centrifugation at 17,000× g for 5 min. Lipid extracts were transferred to glass HPLC vials and analysed as above. S1P lyase assay McNaughton, M., Pitman, M., Pitson, S. M., Pyne, N. J. & Pyne, S. Proteasomal degradation of sphingosine kinase 1 and inhibition of dihydroceramide desaturase by the sphingosine kinase inhibitors, SKi or ABC294640, induces growth arrest in androgen-independent LNCaP-AI prostate cancer cells. Oncotarget 7, 16663–16675. https://doi.org/10.18632/oncotarget.7693 (2016). Schwab, S. R. et al. Lymphocyte sequestration through S1P lyase inhibition and disruption of S1P gradients. Science 309, 1735–1739. https://doi.org/10.1126/science.1113640 (2005). Custodia, A. et al. Ceramide metabolism and Parkinson’s disease-therapeutic targets. Biomolecules https://doi.org/10.3390/biom11070945 (2021).
French, K. J. et al. Pharmacology and antitumor activity of ABC294640, a selective inhibitor of sphingosine kinase-2. J. Pharmacol. Exp. Ther. 333, 129–139. https://doi.org/10.1124/jpet.109.163444 (2010). Generation of Human Embryonic Kidney (HEK)293 cells with doxycycline-inducible expression of FLAG-tagged SK1 was described previously 41. FlpIn SK1-FLAG HEK293 cells and HEK293T cells (ATCC) were maintained in DMEM supplemented with 10% fetal bovine Serum (FBS; HyClone ThermoFisher Scientific) and 1% penicillin–streptomycin (Gibco). MV411 AML cells (ATCC; authenticated by short tandem repeat profiling) were maintained in RPMI supplemented with 10% FBS (non-heat inactivated) and 1% penicillin–streptomycin (Gibco). Human Des1 (E.C. 1.14.19.17, DEGS1) cDNA (Genbank accession number NM_003676) was amplified from human bone marrow cDNA and FLAG epitope-tagged at the 3′ end by polymerase chain reaction (PCR) with Q5 (New England Biolabs, Ipswich, MA) and oligonucleotide primers 5′-TAGAATTCGCCACCATGGGGAGCCGCGTC-3′ and 5′-TAGGATCCTCACTTGTCATCGTCGTCCTTGTAGTCCTCCAGCACCATCTCTCCT-3′. The PCR product was treated with T4 polynucleotide kinase and then digested with EcoRI. pcDNA3 (Invitrogen) was digested with EcoRI and EcoRV prior to ligation with the PCR product to generate pcDNA3-Des1-FLAG. Sequencing verified the integrity of the cDNA. Molecular Therapeutics Laboratory, Centre for Cancer Biology, University of South Australia and SA Pathology, Adelaide, Australia The Counter Fraud Functional Standard was launched in October 2018, and is being implemented across government. It applies to all government departments and their arms-length bodies. As of February 2020, 123 public bodies had adopted the functional standard as the basis for managing the risk of fraud, bribery and corruption in the public sector. Pitman, M. R., Pham, D. H. & Pitson, S. M. Isoform-selective assays for sphingosine kinase activity. Methods Mol. Biol. 874, 21–31. https://doi.org/10.1007/978-1-61779-800-9_2 (2012).Chen, M. H. et al. Identification of SPHK1 as a therapeutic target and marker of poor prognosis in cholangiocarcinoma. Oncotarget 6, 23594–23608. https://doi.org/10.18632/oncotarget.4335 (2015). The standard was developed by counter fraud experts (including from across the public and private sectors, banking and academia) to help guide a whole of government approach. It has been extensively tested in government before its formal release, and represents the minimum that all public bodies are expected to have in place. The International Standards Organisation (ISO) standard, ISO 3601 comprehensively defines both the o-ring and hardware dimensions for rod, piston, face seal grooves.